General Biology - Biology 10
Home Page - Spring 2017


Instructor : Christine Peters-Stanton
Biology Department)                                                                                                                 Biology Home Page
Office : SM 55G                                                                                                                          Instructor Home Page
Phone : (408) 741 - 2626
Email : christine.peters@westvalley.edu


 
Syllabus
Lecture Schedule Lab Schedule Lecture Outlines Grades
Syllabus Quiz Due Feb 8th
Bio10 Lab site
Pre-labs

 
Date Posted Message
5/31/17
Final Grades posted above:
Overall course grade 75%
Final Exam grade: 79%
5/12/17
Final Exam : Monday May22 9:40 - 11:40 SM36
~65% of exam is newest material: Lectures 16 - 20; ~35% is review material..
5/12/17
Homework: Due at of Final Exam
10. Draw an energy pyramid for a terrestrial group of organisms.  Indicted the tropic levels, the types of organisms present in each tropic level (ie producer, primary consumer).  Energy pyramid should be at least 4 tropic levels high.  If the first tropic level contains 100,000 calories, how much energy is in each of the respective tropic levels.
11. Diagram/draw the Carbon Cycle
12. Diagram/draw the Nitrogen Cycle
13. Describe Darwin's Theory of Evolution through Natural Selection
14. List the 4 organic molecules, their respective "building Blocks", and their organismal significance (role within the organism).
5/12/17
Pre Final Course grade posted above:
Average course grade : 74%
Exam 3 class average : 75%
Exam class average: 76%
4/24/17
Exam III: May 1st (Monday)
Exam will cover (Inheritance, male and female reproduction, and cardiovascular): Lectures 10 - 15.

Homework Assignment: #9
6. Draw the a heart: label the four chambers, 4 valves, the major vessels (Superior and Inferior Vena Cava, Pulmonary Artery and Veins, and Aorta).  Please indicate which vessels and chambers have oxygenated blood.
4/19/17 Homework Assignment: #6, 7, & 8 ; Due May 1st day of Exam III
6. Draw the male reproductive system; Start in the testis (indicating the location of semeniferous tubules), include the epididymis, vas deferens, seminal vesicle, prostate, bulbourethral gland and urethra.  Numerically incidate the sequence of structures through which sperm would travel through of past on their way out of the male body.
7. Draw the female reproductive tract; Start at the ovaries (indicate the follicles), fallopian tube (oviduct), uterus, cervix and vagina.  Numerically indicate the sequence of structures an ovulated oocyte (egg) would travel though on the way out of the female body.  Also indicate the location of fertilization and the site of embryo implantation / fetal development.
8. Draw an timeline for the female menstrual cycle: start at day 1, day 2 - 12, day 14, day 14 - 28.  Indicate what is occurring in the ovary (with follicles and corpus luteum and the respective estrogen and progesterone levels),  the uterus (with the endometrium) and the pitutitary gland (with the secretion of follicle stimulating and lutenizing hormones.      
4/19/17 Last day to withdraw from semester length courses is Thursday April 27th.
4/10/16
Current Grades Posted Above:
Class Average Exam II: 76%
Class Course Average: 78%
4/4/17 Homework Assignment: #5 ; Due May 1st

5. Answer the following genetic problems: Please show your punnent squares
   a. Achondroplasia (Dwarfism) is a dominant mutation.  It is inherited as a single gene trait in a dominant recessive pattern.  If two parents Heterozygous normal      
      
parents havechildren, what are the chances they will have a child with achondroplasia (Dwarfism).
   b. Sickle cell anemia is inherited as a single gene mutation in a incomplete dominant pattern.  If one parent has fully expressed sickle cell anemia (hh) and one 
      
parent normal for hemoglobin (HH).  What are the chances they will have sickle cell trait, fully expressed sickle cell, or normal blood?
   c. Blood type proteins are inherited in a single gene co-dominant pattern.  If both parents are type AB, what are the possible blood types of their offspring. 
   d. Can two type A parents have a type O child.  Use a punnent square to answer. 
4/4/17
Homework and previous quizzes can be picked up in the Biology Hallway student drawers (SM55)
3/12/17
Homework Assignment 3 & 4: 5 pts due day of exam II (4/3)

3. Gene Expression:  Start with a DNA strand : TACGTATCGATTTACGCAATT; Transcribe this strand into mRNA; then use the transcribed mRNA to translate the mRNA into a polypeptide chain.  (use your lecture notes or textbook for the mRNA decoder).  You may express the amino acid sequence using its three letter abbreviation. 

4. Mitosis: Draw and label the stages of mitosis: start with a cell that has 4 chromosomes.
3/7/17
Homework Assignments 1 & 2: 5 pts each Due Day of exam II (4/3)

1. Photosynthesis: Write the overall reaction for photosynthesis; Diagram / draw the light (light dependent) and dark (light independent) reactions occurring in the chloroplast. Include the entry of light, where H2O, O2, CO2, ATP, NADPH, ADP +P, NADP+, and glucose are all involved in the processes.

2. Cellular Respiration: Write the overall reactions of cellular respiration: Aerobic and Anaerobic reactions.  Diagram / draw the aerobic cellular respiration that occurs in the mitochondria.  Include the three major reactions involved: a. Glycolysis, Krebs Cycle, and the Electron Transport chain. 

3/6/17
Overall Course grades posted above:
Average Exam 1 Grade: 80%
Average total course grade: 77%
2/21/17
Exam 1: Feb 27th
Monday (Covering weeks 1 - 4).
Lectures 1 - 4 (through cell structures chloroplast ; will not include details of cell membrane that follow)
Please bring a scantron and pencil

1/7/17
Class Cancelled Wednesday: Due to road closures on Hwy 17.
1/30/17
Great first day!
Reminder:
1. Please download lecture 2 for next class
2. Please download syllabus quiz and answer the questions on a scantron form (882) - Due Feb 8th
3. Please have accessible a General Biology textbook and purchase Quiz scantrons (15 question 815) for next week
Note: total points in the semester are 710 (not 835).
1/19/17
Welcome to Biology 10 - General Biology!
3 units  - Lecture, 1 unit Laboratory
Lecture 3 hours; Laboratory 3 hours
Prerequisite: None 
Recommended preparation: Math 902, Library 4 (Information Competency) 
Acceptable for credit: University of California, California State University
Introductory course designed for non-science majors.  Emphasis is placed on the fundamental process of life, including the structure and function of cells, plants, animals, human systems; genetics; evolution; diversity and ecology.

Note : Bio10 is NOT open to students who have completed Bio11 (Human Biology) with a C or better.  Bio 10 and Bio11 meet the same educational requirements.  Students will receive only unit but not grade credit.
 

1/19/17 Class starts Jan. 30:  Be sure to show up the first day of Bio10 Lecture (Monday Jan. 30) AND LAB (day depends on section). Anyone that misses the first day of class will be automatically dropped to allow other students an opportunity to add. 

Things to do to get a head start :

1. Ready over Syllabus : You can down load a printable version of the Syllabus (pdf.).

2. Read over the Lab Safety Information at the beginning of lab manual.

3. Take the Syllabus Quiz : Down load the quiz (Syllabus Quiz (pdf)and answer the questions on a separate scantron (882) after reading the syllabus.  The syllabus quiz is due Wednesday Feb. 8th at the beginning of class.
 

1/19/17
ADDING the Lecture Class: If you would like to ADD show up the first day of class and I will add your name to my wait list but you will only be officially added when you show me your lab add code and I give you a lecture add code to add on line.

Make getting into a lab a priority.I will only ADD students that are registered in a lab section.    There is plenty of space in lecture (this is not a problem),  it is the lab which has the constraint on enrollment.

To add a lab you can : 
1. Show up to the beginning of any  available lab section.  any open seats can be assigned to prospective students
2. Contact the instructor ahead of time.  They may be willing to add you to their role sheet is space is available.
 

1/19/17
Purchasing Course Books: Several options are available to you: 

Required Texts : 

a. Biology 10 General Biology Laboratory  Manual Spring 2017 Edition. ; West Valley College
b. Campbell Essential Biology with Physiology W/ access code, Pearson

1. Viking Bookstore : West Valley Campus Bookstore: You can Purchase all of the books listed in the syllabus directly from the bookstore located  on West Valley campus. The bookstore also provides an online service (http://westvalley.bkstore.com/) so that you can reserve books & pick them up later or make arrangements for home delivery.   Unfortunately the laboratory manual can only be ordered from the campus bookstore.  It should be available one week before classes start.

2. Online Ordering : For ordering all materials except the laboratory manual.  Since the prices of texts books is definitely a concern you may want to look into purchasing textbooks from a less expensive internet vendor.  The only concern is how long it will take to deliver the text.  If you choose to order from an internet site and your text does not arrive when classes start you can keep up with the required reading by using the text on reserve in the library. 
       Amazon.com   or  Half.com
 If you have knowledge of any other sources please let me know (email: Christine peters@westvalley.edu)

3. WVC Library (Reserve Desk) : The Library's reserve desk will have one copy of the current text book which can be checked out for 2 hour blocks of time.  Do not wait until the last minute to do your reading since others may also be relying on the reserve text for their reading.  The library is open M - Th 8:00am - 7:30pm , F 8:00 - 12 noon, Sat noon - 4:00   (408) 741-2028

PLEASE PURCHASE LAB MANUAL FOR THE SECOND LAB (Lab one will be provided to you in the first weeks lab)

1/19/17
Accommodations for a Disability: West Valley College strives to make all learning experiences as accessible as possible. If you anticipate or experience academic barriers based on your disability (including  permanent disabilities or chronic or temporary medical conditions), please let me know immediately so that we can privately discuss options.  You are also welcome to register with the Disability and Educational Support Program to establish reasonable accommodations.  After registration, DESP will notify me of your approved accommodations.
DESP contact information: The DESP office is located in the LS building; their phone number is (408) 741-2010 (voice) or (408) 741-2658 (TTY). Information about their services can be found at www.westvalley.edu/desp/
 
1/19/17

HELP : Tutoring available through the WVC tutorial services: Chick here for drop in tutoring schedules
1/19/17 Visit Fun Animation : Spoof on Star Wars

     Store Wars with Cuke Skywalker, Obi Wan Cannoli, Chewbroccoli  and Lord Tator

1/19/17 Really amazing Video on RNAi : here is the link 

Journals Sites :  Good Reference Web Sites
Great Sites for Study Tips :  Applicable Information
  • Red Sox Pitcher injures his Peroneus Longus tendon sheath : Unprecedented surgery saves Game 6 - Article
  • Lecture Question about tendon / ligament adaptation to exercise : Answer YES tendons / ligaments strengthen in response to exercise : Journal of Rehabilitation & Research Development





West Valley College  
Page created by: Christine Peters-Stanton
Updated: Aug. 20,  2012